Quantcast
Channel: Post Feed
Viewing all articles
Browse latest Browse all 3147

Programming Challange: Pairwise Alignments To Multiple Alignment

$
0
0
I have a set of 10-12 very closely related chromosome sequences (from different strains) aligned to a "single" reference chromosome. Now I need to generate multiple sequence alignment of these without afftecting individual alignments to the reference. All that I need is to add relative inserts at respective sequence positions, so that I get a global alignment with respect to reference."Note. Here I am NOT looking for sequence similarities". I hope some scripts are already available to do this? I dont want to reinvent the wheel. OR any suggestions to script (preferably in perl) to address this problem. Adding more information: What I need is to do is to "add dashes" at relative "insert" positions in other sequences, so that I get a global alignment with respect to reference. For example with 10 sequnces: If from position 30 to 55 in seq1 has an insert. but not in other 9 sequences. In the final expanded alignment I will insert 26 dashes (-) (from 30-55) in the sequences 2 to 10 and in the reference. And in another situation like above if seq1 has insert at 30-55 and if seq3 has insert from 40-45 and seq6 has insert from 42-49. Then I need to insert dashes like above, except in these positions (in seq3: 40-45 and in seq6: 112-119) Sample Input: Original reference: CGACAATGCACGACAGAGGAAGCAGAACAGATATTTAGATTGCCTCTCATTTTCTCTCCC Pairwise alignments: Ref1: CGACAAT--GCACGACAGAGGAAGCAGAACAGATATTTAGATTGCCTCTCATTTTCTCTCCC Se ...

Viewing all articles
Browse latest Browse all 3147

Trending Articles