Is there any way to quantify differences between neighbour-joining...
I am working on a project and I am currently only using the SNP data to make my trees. I would like to compare the trees made using SNP data to the trees made using indel data to ensure they are...
View ArticleTool: Varscan: Variant Detection In Massively Parallel Sequencing Data
VarScan is a platform-independent mutation caller for targeted, exome, and whole-genome resequencing data generated on Illumina, SOLiD, IonTorrent, Roche/454, and similar instruments. The newest...
View Article1000 Genomes Indel/Snps File
Is there any place to download 1000 genome SNPs and Indels data in a single merged file for each pilot (pilot 1 , 2 , and 3) ? I am trying to use GATK and thought to use 1KG indels and SNPs vcf files...
View ArticleHow To Calculate Genotype Concordance Between Indel Call Sets?
How do people calculate genotype concordance between INDEL call sets? I have a NGS and BAC based INDEL call set (in vcf) but I get a higher false positive and false negative rate than mentioned in some...
View ArticleProgramming Challange: Pairwise Alignments To Multiple Alignment
I have a set of 10-12 very closely related chromosome sequences (from different strains) aligned to a "single" reference chromosome. Now I need to generate multiple sequence alignment of these without...
View ArticleHow To Call Variants (Snp, Indel, Sv) On A Bac Contig Aligned With Bwa Mem To...
I aligned a BAC contig (assembled from sanger sequences) to a reference genome using BWA-mem. The output alignments are very similar to the best end to end alignment I got from aligning the bac contig...
View ArticleClik here to view.
Indel Left/Right Alignment
When matching indels between different VCF files (generated by different callers), there is this issue with left / right indel alignment, For example: Here is a real example for one indel (from the...
View ArticleLocating Indels In Gene
I have a excel file from windows (spreadsheet) contains start, end and indel sequences (-GGC means GGC deletion or +AAC means AAC insertion) in column 1, 2 and 3 respectively. I have a reference genome...
View ArticleSamtools Indels -- Filtering Only Hits With Insertion In The Reference In The...
Can anyone suggest how to use samtools to filter only hits where there is a insertion in the reference that splits the sequence hit roughly by the middle? My sequences are in the range of 100-1000bp...
View ArticleDetecting Cancer Somatic Mutations From Multi-Sample Low-Pass Wgs Data
Hi All,Q1. I'm trying to find recurrent mutations (SNPs and indels) from multi-sample (~100) low-pass (3~4x) whole genome sequencing data for a certain cancer type. They are all paired with matched...
View ArticleSomaticindeldetector Vs Unifiedgenotyper
Hey Guys, I've been establishing my own first pipeline for calling variants: Indels and SNPs. For that, I used mainly GATK tools. I'm doing this for whole genome and whole exome sequences of mouse...
View ArticleGenerate pileup for indels only using SAMtools mpileup
Is there a way to generate a pileup for indels only using the samtools mpileup command? The -I flag can be used to skip indel calling but there is no option to call indels only.Thanks.
View ArticlePython - finding INDELS and SNPS
seq_a = 'GAGAGATTTTCCAATTCGACG-------CGGGGTCAGG--GAAATTT' seq_b = 'GAGAGATTGGCCTTAACTACCCAACCCACGGCCTGACCGAGGTCTTC'G A C T = Bases- = INDELPYTHON - I am very new to programming and need some help, I...
View ArticleWhat Is The Difference Between Samtools Mpileup And Pileup
As of samtools 0.1.8 'mpileup' appears to have superseded 'pileup' for variant detection. The samtools website now has pileup as deprecated. So i am wondering whether i should repeat my recent...
View ArticleHow To Identify/Flag The Presence Of Indels On The Read Level Nearby A Given...
Let's say I have list of genomic positions, e.g. SNP calls in a VCF file, and a BAM file with read alignments. What would be the best way to, for each of those positions, determine if in the BAM file...
View ArticleHow Many Is Too Many? Germline And Somatic Coding Indels And Snps In Cancer...
Would anyone care to share their experience with variant calling in cancer genomics using tumor - normal pair to find somatic vs germline variants especially indels?I have been getting an unbelievably...
View ArticleAnyone Know A *General* Variant (Snp/Indel) Effect Predictor / Annotator?
I'm looking for a general variant annotator ... one that would call a variant as synonymous, non-synonymous, non-genic, UTR, frame-shift, truncation, etc. By general I mean that we should be able to...
View ArticleHow To Handle Reads Ending With Deletions In Gatk?
Hello,before asking my question, I should point out that I'm working with data that's not my own (publicly available), to learn and establish a proper workflow when real data wlll arrive in the...
View ArticleWhat Approach Would You Recommend For Large Indel Detection With Solid Data
I've been spending quite some time on following problem: I sequenced a bacterial genome using paired-end reads (SOLiD) and I have a quite good reference sequence. My goal is to detect changes in the...
View ArticleSamtools / Bcftools Missing Random Obvious Single Base Indels
I am using samtools to call variants in a haploid genome (yes I know it is designed for diploid). It finds SNPs easily, and most of the indels, but there are a few indels it can NOT seem to find no...
View Article