Best Way To Compare Output Snp/Indels From Different Software?
I have a list of SNPs and indels from 4 different software. IndelGenotyper (broad tool)—for calling somatic indels Bambino—for calling SNP/Indels Somaticsniper—SNP calling Varscan – indel/snp/LOH Now...
View ArticleBwa Indels
Comparing bwa 0.6.2 to bwa 0.5.9 I'm seeing very different behavior around indels. I'm using default options in both cases and as far as I can tell they haven't changed. I'm aligning Illumina paired...
View ArticleBwa Aln For Snp/Indel Discovery With Paired End 100Bp Human Dna Reads
Hi, Can anyone show me a recommended command line input to achieve this? I have never used the program before and am afraid of entering inappropriate values for one of the many paramters.Or is there a...
View ArticleInterpretation of InDels obtained from the Freebayes variant caller on...
Hello, I am calling variants on mitochondrial genomes using freebayes. I am using the following command: freebayes -f $REF -p 1 -F 0.6 $BAM | $VCFFILTER -f "QUAL > 20" > $F_6_OUT I have been...
View ArticleWhat Is The Difference Between Samtools Mpileup And Pileup
As of samtools 0.1.8 'mpileup' appears to have superseded 'pileup' for variant detection. The samtools website now has pileup as deprecated. So i am wondering whether i should repeat my recent...
View ArticleStrange variant call it show a indel but looks like a SNP
Hello all, i have a variant from a ION PGM sequencing, called with the ION Torrent variant caller plugin CHR Â Â POS Â Â Â ID Â Â REF Â Â Â ALT chr22 Â 44324726Â . Â Â Â TÂ Â Â Â Â Â TG The flow cell...
View ArticleSplit Vcf File Into Snps And Indels
Hi there,As recommended in the GATK best practices the Variant Quality Score Recalibration has to be done separately for SNPs and Indels. But, I didn't find the way to do this split in a clean way (for...
View ArticlePython - finding INDELS and SNPS
seq_a = 'GAGAGATTTTCCAATTCGACG-------CGGGGTCAGG--GAAATTT'Â Â seq_b = 'GAGAGATTGGCCTTAACTACCCAACCCACGGCCTGACCGAGGTCTTC'G A C T = Bases- = INDELPYTHON - I am very new to programming and need some help, I...
View ArticleSnps And Indels In Homozygous Genomes
I have a genomic sequence of an inbred mouse strain i.e. the genome is homozygous for a given position or same alleles are present on both of the strands. Now for variant calling, I have to compare it...
View ArticleHow To Call Variants (Snp, Indel, Sv) On A Bac Contig Aligned With Bwa Mem To...
I aligned a BAC contig (assembled from sanger sequences) to a reference genome using BWA-mem. The output alignments are very similar to the best end to end alignment I got from aligning the bac contig...
View ArticleNgs Tool Analysis For Snp&Indel Calling Of Pooling Data
What are the best and most used analysis tool actually, for SNP and indel calling of pooled data?I'm using: GATK Freebayes that have specified options for data in pool.Now I have found CRISP.Are there...
View ArticleTools For Large Indels Discovery In Single-End Rna-Seq Reads
Hi all,Has anyone heard about any tool wich could deal with large indels discovery? I've found some for paired-end reads but never for single-end... My final goal is to find transposable elements...
View ArticleHow To Calculate Genotype Concordance Between Indel Call Sets?
How do people calculate genotype concordance between INDEL call sets? I have a NGS and BAC based INDEL call set (in vcf) but I get a higher false positive and false negative rate than mentioned in some...
View ArticleHow To Make A Circular Plot Of Snps And Indels ??
Hello everybody,I am analysing SNPs and INDELs in several prokaryotic genomes of the same strain. My goal is to compare them with a reference genome . I would like to learn how to plot the SNPs in a...
View ArticleGatk Indel Realignment Error - Mismatch In Index Files And Dict File
Greetings,I am aligning pooled sequencing data to a new renferece genome. GATK won't generate intervals because not every scaffold in the reference is found in my bam index?What am I missing? It seems...
View ArticleHow to call low frequency snp/indel with GATK's HC/UG
i want to call snp/indel with low frequency, like DP=100, ALT=10.how to set HC/UG ?with UG, i run with :--min_indel_count_for_genotyping 2--min_indel_fraction_per_sample 0.05get a nice result, but i...
View ArticleSequence Variation Detection For Prokaryotic Genomes
I have resequenced a bacterial genome using SOLiD paired end reads. After looking at SNPs and small Indels, I'm now interested in large Insertions/Deletions (Size of genes and gene clusters).Which...
View ArticleHow To Identify/Flag The Presence Of Indels On The Read Level Nearby A Given...
Let's say I have list of genomic positions, e.g. SNP calls in a VCF file, and a BAM file with read alignments. What would be the best way to, for each of those positions, determine if in the BAM file...
View ArticleHow To Retrieve Reads Supporting A Snp/Indel
I used samtools and varscan for variant calling like this:samtools mpileup \ -f genome.fa \ tku.sorted.rmdup.bam \ | java -jar VarScan.v2.3.5.jar pileup2snp \ --min-coverage 8 \ --min-reads2 2 \...
View ArticleStructural Variation Detection On A Short Reads Simulation
Hi,I am trying to do the following exercise (still playing with indels):simulate short reads (and indels) out of a human genome chromosome,align the short reads simulated in (1),call indels using a SV...
View Article