Quantcast
Channel: Post Feed
Browsing all 3147 articles
Browse latest View live

Python - finding INDELS and SNPS

seq_a = 'GAGAGATTTTCCAATTCGACG-------CGGGGTCAGG--GAAATTT'   seq_b = 'GAGAGATTGGCCTTAACTACCCAACCCACGGCCTGACCGAGGTCTTC'G A C T = Bases- = INDELPYTHON - I am very new to programming and need some help, I...

View Article


What Do You Expect As The False Positive And Negative Rate For Snp'S And...

What do you expect as the false positive and negative rate for SNP's and INDELS in a WGS experiment?On which papers and data sets (inhouse or external) do you base this? Edit: Of course this depends on...

View Article


Tool: Varscan: Variant Detection In Massively Parallel Sequencing Data

VarScan is a platform-independent mutation caller for targeted, exome, and whole-genome resequencing data generated on Illumina, SOLiD, IonTorrent, Roche/454, and similar instruments. The newest...

View Article

Benchmarking Read Alignment And Variant-Calling Algorithms (For Dummies)

Hi all, I am wondering if there is a good step by step guide of how to benchmark alignment and variant calling software. I do understand the premise e.g.Generate reads with known mutations Align to...

View Article

Trio: Detecting A Large De Novo Indel

I've been given a set of three BAM (father, mother, child) and I expect the child to contains some de-novo heterozygous variations . samtools mpileup have been used to find the small variations but...

View Article


Comparative Genomic Analysis Of Bacterial Field Strains

Hi, I have a question on comparative genomics of bacterial field strains.If there is a very low number (only 30) of variants (base substitutions, indels etc) in a comparative genomics study of several...

View Article

Arlequin Input Frequency Data

Hi!I have frequency data for 50 biallelic loci and 500 samples in 3 populations and i can´t understand how to create an input file for arlequin with these data. If someone could help me it will be...

View Article

How To Make A Circular Plot Of Snps And Indels ??

Hello everybody,I am analysing SNPs and INDELs in several prokaryotic genomes of the same strain. My goal is to compare them with a reference genome . I would like to learn how to plot the SNPs in a...

View Article


Indel Discovery Delly, Pindel, Samtools, Gatk

I'm testing out samtools vs GATK for snp and indel calling, and looking at using pindel for SV in particular focusing on insertions and Delly for the other SV. What experience do people have of SNP...

View Article


Functional Consequence of In-frame Indel

Does anybody include in-frame indels in association studies? A quick pubmed / google / biostars search on this didn't come up with much. In-frame indels are often treated as synonymous, but since they...

View Article

Searching For Deletion In A Low Number Of Reads

Hi everybody,I am having sort of a non-conform problem.we have a mutated mitochondrial genome (circular) of high coverage (~x10k). We know that there are a few deletions and insertions in there due to...

View Article

Detecting Cancer Somatic Mutations From Multi-Sample Low-Pass Wgs Data

Hi All,Q1. I'm trying to find recurrent mutations (SNPs and indels) from multi-sample (~100) low-pass (3~4x) whole genome sequencing data for a certain cancer type. They are all paired with matched...

View Article

Pindel Error: Shiftedvector Out-Of-Range Error

Hello,I’ve been running pindel like so: pindel --config-file bam_config.txt --fasta /path/to/hg19/fasta/ --chromosome ALL --output-prefix /path/to/outputand I’ve noticed a lot of my pindel jobs fail...

View Article


Somaticindeldetector Vs Unifiedgenotyper

Hey Guys, I've been establishing my own first pipeline for calling variants: Indels and SNPs. For that, I used mainly GATK tools. I'm doing this for whole genome and whole exome sequences of mouse...

View Article

BWA Small Indels vs Roche Newbler Assembler

I've been experimenting with using BWA to assemble 454 (1kb reads), comparing previous assemblies performed with the proprietary Roche assembler and I've noticed that BWA seems to be able to handle...

View Article


Interpretation of InDels obtained from the Freebayes variant caller on...

Hello, I am calling variants on mitochondrial genomes using freebayes.  I am using the following command:  freebayes -f $REF -p 1 -F 0.6 $BAM | $VCFFILTER -f "QUAL > 20" > $F_6_OUT I have been...

View Article

Samtools / Bcftools Missing Random Obvious Single Base Indels

I am using samtools to call variants in a haploid genome (yes I know it is designed for diploid). It finds SNPs easily, and most of the indels, but there are a few indels it can NOT seem to find no...

View Article


Generate pileup for indels only using SAMtools mpileup

Is there a way to generate a pileup for indels only using the samtools mpileup command? The -I flag can be used to skip indel calling but there is no option to call indels only.Thanks.

View Article

What Is Difference Between Gatk And Dindel For Calling Indel

What is difference between GATK and Dindel for calling indel ,I see that in the GATK second step :discovery indel ,The genotype likelihoods calculation is inspired by Dindel.So I want to know the...

View Article

Multi-Sample Indel Realignment Using Gatk

Is there a way to use the GATK Indel Realigner tool with a two-samples-input? The issue is that in my normal sample, several reads are mapped containing SNPs at specific positions, and ONE read having...

View Article
Browsing all 3147 articles
Browse latest View live